biology

1. which cell structure contains cytoplasm?
a chloroplasts
b~ mitochondria
c_ plasmodesmata
d smooth endoplasmic reticulum

2 some cell structures are listed in a particular order.
1 nucleus
2 ribosome
3 golgi body
4 vesicle
what determines the order in which these cell structures are listed?
a sequence used in synthesis of a lipid
b sequence used in synthesis of an antibody
c size from largest to smallest
d _ size from smallest to largest

3 the drawing has been made from a section showing part of an alveolus and a red blood cell in a
capillary. the magnification of the drawing is x5000.
_eo mations
an
ss
red blood cell
what is the minimum distance that oxygen must diffuse from air in an alveolus into the red blood
cell?
a 0.1nm b 1.0nm c 0.1m d 1.0um

4 four students were asked to match the function with the appearance of some cell structures in an
animal cell.
the functions were listed by a number.
1 mrna passes through to the ribosome
2 _ synthesis of polypeptides
3. packaging of hydrolytic enzymes that will remain in the cell
the appearances were listed by a letter.
vs membranes which surround an enclosed inner cavity
w_non-membrane bound, spherical structures
x adouble membrane interspersed with pores
y —non-membrane bound, cylindrical structures
z membrane-bound sacs, arranged as a flattened stack
which student correctly matched the numbered functions with the appearance of the cell
structure?
[|] 2] 2] 2 |
a vv xx y
b vv zz zz
cc x www z
d xx z www

5 the antibiotic chloramphenicol inhibits protein synthesis in mitochondria and in some
prokaryotes. chloramphenicol does not inhibit protein synthesis in the cytoplasm of eukaryotic
cells.

what would be the effect on the cells of a person being treated with chloramphenicol?
| | rate of atp production transcription of nuclear dna

a decreases decreases

b decreases no effect

cc increases decreases

d no effect no effect

7 which colour indicates the lowest concentration of reducing sugar present in a solution after
testing with benedict’s solution?
a brown
b green
cred
d_ yellow

8 which molecules are monomers?
1 ribose
2 glucose
3 deoxyribose
4 sucrose
a 1,2and3 b 1,2and4 c 1,3 and4 d 2,3 and4

9 which molecules have properties that are dependent on hydrogen bonds?
1 cellulose
2 glycogen
3 haemoglobin
4 water
a 1,2and3 b 1,2and4 c 1,3and4 d 2,3and4

10 some features of triglycerides are listed.
1 can be liquid or solid at room temperature
2 contains a high proportion of carbon—hydrogen bonds
3 insoluble in water
4 less dense than water
which of these features make triglycerides suitable energy stores?
a 1and2 b iand4 c 2,3and4 d 2and 3 only

11 some foods contain hydrogenated vegetable oils. these are unsaturated fats that have been
converted to saturated fats.
which property of the fats will have changed?
a their hydrocarbon chains will fit together more closely.
b_ their solubility in water will increase.
c_ they will have more double bonds in their molecules.
d_ they will remain liquid at room temperature.

12 which statements could be used to describe enzyme molecules and antibody molecules?

1 hydrogen bonds stabilise the structure of the protein and are important for it to
function efficiently.

2 hydrophilic r-groups point in to the centre of the molecule and cause it to curl into a
spherical shape.

3 the tertiary structure of the protein molecule plays an important role in the
functioning of the protein.

a 1,2and3 b 1and2only c 1and3only d = 2and3only

13 the vmax and k,, are determined for an enzyme-catalysed reaction.
what will be the effects on the vinax and km in the presence of a competitive inhibitor?
ce
a decreases increases
b increases decreases
cc stays the same decreases
d stays the same increases

14 the graph shows how the concentration of components,1, 2, 3 and 4, of an enzyme-catalysed
reaction changes with time.
1
concentration
2
3
4—_
time
which row identifies the components of this reaction?
component 1 component 2 component 3 component 4
a | enzyme-—substrate | unbound enzyme product substrate
complex
b | enzyme-substrate product substrate unbound enzyme
complex
cc product enzyme-—substrate | unbound enzyme substrate
complex
d product unbound enzyme substrate enzyme-—substrate
complex

15 which statement suggests that a membrane protein is involved in active transport?
a it allows movement of molecules across a membrane if concentration differences exist.
b_itcan only function if mitochondria are supplied with sufficient oxygen.
c_ithas a tertiary structure with a binding site with a specific shape.
d itis found in the cell surface membranes and the mitochondrial membranes.

16 cell surface receptors used in cell signalling are usually proteins that extend from one side of the
membrane to the other side of the membrane.
what is the role of the extracellular part of the protein?
a binding the signalling molecule
b_ functioning as an enzyme
c increasing the solubility of the receptor
d transmitting the signal from the target cell

17 which substances can pass directly through cell surface membranes and do not use a carrier
protein or channel protein?
1 k* and cl
2 co.
3 ceh1206
a 1and2 b 1and3 c 2and3 d 2only

18 a student put a layer of plant epidermal cells on a microscope slide. the student put a drop of
potassium nitrate solution on the layer of cells and observed that:
e the cell surface membrane of many of the cells had separated from the cell wall
e the cytoplasm and cell contents had shrunk.
what explains these observations?
aa eae [a
movement at start/kpa solution at start/kpa
a cells to solution —100 -500
b cells to solution —500 -100
cc solution to cells —100 —500
d solution to cells —500 -100

19 the enzyme telomerase prevents loss of telomeres after many mitotic cell cycles.
which cells transcribe a high concentration of telomerase?
1 neutrophils
2 mature red blood cells
3 activated memory t-lymphocytes
a iand2 b 1tand3only c 1 only d = 3only

20 at which stage of mitosis do these events occur?
[cmon | sre
shorter and thicker
a anaphase interphase
b anaphase prophase
cc metaphase interphase
d metaphase prophase

21 which components could be found in nucleotides of rrna?
1 any one of two different nitrogenous bases with a double ring structure
2 any one of two different purine bases
3. any one of three different nitrogenous bases with a single ring structure
4 any one of three different pyrimidine bases
a 1,2,3and4 b 1and2only c t1and4only d = 3and4only

22 how many statements are true for semi-conservative replication of dna in a prokaryotic cell?
1 the process takes place in the cytoplasm
2 anadenine nucleotide will line up against a uracil on the template strand
3 each new dna molecule will contain one strand from the parent molecule
4 __ if the parent molecule contained 40% guanine nucleotides each new dna molecule
will contain 20% guanine nucleotides
a 1 b 2 cc 3 d 4

23 sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the b-globin

polypeptide of haemoglobin.
the diagram shows the sequence of bases in a small section of the coding strand of dna for
both the hb* (normal) and hb’ (sickle cell) b-globin alleles.

hb* ctgactcctgaggagaagtct

hbs ctgactcctgtggagaagtct
how will the mutation in the allele result in the production of an altered version of the
b-globin polypeptide?
a atrna molecule with the anticodon gug will hydrogen bond to the altered codon on mrna.
b_ all the amino acids coded for after the mutation will differ from those in the hb‘ protein.
c mrna transcribed from the hb° allele will contain the codon cac instead of the codon ctc.
d_ the ribosome will be unable to continue translation of the hb® mrna after the altered codon.

24 the diagrams show some tissue types in plant organs.
1
2
© 4
“ -
+; vg ,v
8 ,
which row identifies the tissue types?
ee ee ee
a phloem phloem phloem xylem
b phloem xylem phloem xylem
cc xylem phloem xylem phloem
d xylem xylem phloem xylem

25 which row correctly describes the adaptations of companion cells, phloem sieve tube elements
and xylem vessel elements for their roles?
| | companion cell | phloem sieve tube element xylem vessel element
a a thin layer of cytoplasm strong, lignified cell walls many plasmodesmata
to reduce resistance to flow for supporting the plant for communication
between cells
b empty cells allowing many plasmodesmata strong, lignified cell walls
water to flow freely for communication for supporting the plant
between cells
cc many plasmodesmata a thin layer of cytoplasm empty cells allowing
for communication to reduce resistance to flow water to flow freely
between cells
d strong, lignified cell walls empty cells allowing a thin layer of cytoplasm
for supporting the plant water to flow freely to reduce resistance to flow

26 irrigating crop plants with water containing low concentrations of salt causes an increase in the
concentration of salt in the soil.
what explains why the increase in salt concentration could eventually kill the crop?
water potential water potential direction of water
in roots in soil movement

a decreases out of the roots

b increases into the roots

cc decreases out of the roots

d increases into the roots

27 +the diagram shows the pathway of water across root cells to the xylem.
which cell is in the endodermis?
[ ——_—_ —_— ——_—_
| a il b il cc il d ' xylem

28 which row shows the cause of mass flow in the phloem and the direction of movement of phloem
sap by mass flow?
cause of mass flow direction of movement
in the phloem of phloem sap by mass flow
a hydrostatic pressure gradient sink to source
b hydrostatic pressure gradient source to sink
cc water potential gradient sink to source
d water potential gradient source to sink

29 which statement about oxygen combining with haemoglobin is correct?
a_ all oxygen molecules which combine stop the haemoglobin molecule changing shape.
b_ four oxygen molecules can combine with each haem group.
c_ the first oxygen molecule to combine does not affect the shape of haemoglobin.
d_ the second oxygen molecule to combine makes it easier for the third to combine.

30 the diagram shows the bohr effect.
100 =
80 pa
percentage 60 x f
saturation of /
haemoglobin gy
with oxygen 40 /
20 #
ol
0 2 4 6 8 10
partial pressure of oxygen/kpa
what causes the shift from x to y?
a decreased concentration of carbon dioxide and high ph
b_ decreased concentration of carbon dioxide and low ph
c_ increased concentration of carbon dioxide and high ph
d_ increased concentration of carbon dioxide and low ph

31 which plan diagram represents the tissues in a major vein?
a b
cc d

32 ventricular septal defect (vsd) is a heart defect that people can have from birth. people with
vsd have a hole in the wall (septum) that separates the left and right ventricles.
what could happen in a person with vsd?
1 blood will leak through the hole, mostly from right to left.
2 the volume of blood circulating through the lungs will be higher than in a person
without vsd.
3 less oxygen will be delivered to the body tissues.
a 1,2and3 b tand2only c tand3only d 2and3only

33 the diagram shows the pressure changes in some structures of the right side of the heart during
the cardiac cycle.
an
y/, \
/ \
pressure | \ x
/kpa \
| \
| \
core, | =
0 wer” nye = pcl 7 a
0 0.2 0.4 0.6 0.8
time/s
which structure is represented by x?
a pulmonary artery
bright atrium
c right ventricle
d_ vena cava

34 the diagram shows a section through a type of epithelium.
() l
joon
[s8e0)
v
ie 80m
where is this type of epithelium found in the respiratory system?
a jv v jv key
b v v x ¥ = present
cc v x v x = not present
d x jv v

35 in chronic obstructive pulmonary disease (copd), airflow through the airways is reduced.
which statements explain the reduced airflow?
1 more mucus is secreted into the airways.
2 airways and alveoli lose their elasticity.
3 many of the alveoli are destroyed.
4 carbon monoxide binds irreversibly to haemoglobin.
a 1,2,3and4
b 1,2 and 3 only
c 1,3 and 4 only
d 2,3 and 4 only

36 outbreaks of cholera commonly occur in refugee camps that are set up after a major natural
disaster such as earthquakes.
the list shows some measures that can be taken to limit the spread of cholera in the refugee
camps.
1 treating all drinking water supplies with a high concentration of chlorine
2 setting up an emergency treatment centre to isolate cases of cholera and treat them
with antibiotics
3 using concentrated disinfectant to clean sewage disposal areas and infected
bedding
4 health workers visiting regularly to detect cases
5 keeping good records of the number of cases and deaths at treatment centres
which features of these control measures involve an economic factor?
a 1,2,3,4and5
b 1,3 and 5 only
c 2,3,4 and 5 only
d 2and4only

37 which use of antibiotics helps to reduce the spread of resistance in bacteria?
a __ using high concentrations of the antibiotic to kill all the bacteria
b giving routine preventative antibiotics to people who are having an operation
c_ regularly changing the type of antibiotic used to treat particular bacterial infections
d giving antibiotics to treat low level infection caused by a bacterium

38 the graph shows the amount of antibody produced in response to an antigen.
concentration
of antibody
in the blood
0 10 20 30 40
t time in days
first exposure to an antigen
from the graph, which statement is correct?
a it takes 25 days to achieve active immunity.
b memory cells for this antigen are present in the body within 20 days.
c_ t-helper lymphocytes are activated on day 12.
d_ the second exposure to the antigen occurred on day 25.

39 which sequence summarises the hybridoma method for the production of monoclonal
antibodies?
a b cc d
inject mammal inject mammal inject mammal inject mammal
with antibodies with antibodies with antigens with antigens
+ 1 l +
harvest harvest harvest harvest
antibodies b-lymphocytes antibodies b-lymphocytes
from blood from spleen from blood from spleen
l l l l
test for fuse with test for fuse with
wanted antibody cancer cells wanted antibody cancer cells
+ 1 l +
fuse with test for fuse with test for
cancer cells wanted antibody cancer cells wanted antibody
+ l + +
large scale large scale large scale large scale
culture culture culture culture

40 the vaccination programme for smallpox was a medical success story which resulted in the
world health organisation finally declaring the world free from smallpox in 1980.
which statement correctly identifies the reasons for the success of the smallpox vaccination
programme?
a the virus also infected animals making it easy to stop the transmission cycle.
b_ the virus remained in the body following infection and could become active later.
c_ the virus was stable and not prone to mutations.
d_ the virus was unstable and prone to mutations.

Solve 9700_w19_qp_11